pottergirl5oo
New member
- Jul 3, 2008
- 2
- 0
- 1
I got dumped with a science project to do by myself because my partner didn't decide to help me and it's due tomorrow, so help with this would be very helpful!
1) Can you provide the correct amino acid sequence for the DNA sequence provided of hemoglobin:
CATGTGAGTGGGGACTCCTCTTTAGTCGACATTGC
2)Explain the process of transcription?
3)Detail the difference in structure and function of DNA, mRNA, and tRNA.
*You don't have to answer all of the questions, but even the slightest amount of help would be awesome! : ) *
1) Can you provide the correct amino acid sequence for the DNA sequence provided of hemoglobin:
CATGTGAGTGGGGACTCCTCTTTAGTCGACATTGC
2)Explain the process of transcription?
3)Detail the difference in structure and function of DNA, mRNA, and tRNA.
*You don't have to answer all of the questions, but even the slightest amount of help would be awesome! : ) *